Products/Services Used | Details | Operation |
---|---|---|
Gene Synthesis> | The following primers were designed using the online tool at https:// www.genscript.com/tools/real-time-pcr-tagman-primerdesign-tool: CsMAPEG-qF, CGCGCTCGCAAGAAGTATAA; and CsMAPEG-qR, GAAGCGGTAAGGCAAGGA TG. | Get A Quote |
Propamocarb (PM) is one of the main pesticides used for controlling cucumber downy mildew. However, due to its volatility and internal absorption, PM can easily form pesticide residues on cucumber fruits that seriously endanger human health and pollute the environment. The breeding of new cucumber varieties with a low abundance of PM residues via genetic methods constitutes an effective strategy for reducing pesticide residues and improving cucumber safety and quality. To help elucidate the molecular mechanism resulting in a low PM residue abundance in cucumber, we used the cucumber cultivar 'D0351' (which has the lowest PM residue content) as the test material and identified genes related to low PM resid... More