Products/Services Used | Details | Operation |
---|---|---|
CRISPR Libraries> | ... For HNF4A stable knockout in NorHep cells, a CRISPR/Cas9 lentiviral transduction approach was employed. gRNA (guide RNA) scaffold sequence (GGGCGCGTTCACGCTGACCA) targeting HNF4A gene (GeCKO library [41]) was cloned into pLentiGuide-Puro (GenScript). ... | Get A Quote |
AIM: DNA methylation downregulates transcription. However, a large number of genes, which are unmethylated in the promoter region, are inactive. We tested the hypothesis that these genes are regulated by DNA methylation of upstream regulators. METHODS: We inhibited DNMT1 with 5-aza-2'-deoxycytidine or depleted it with shRNA to map the transcription initiation positions controlled by DNMT1 using ChIPseq with RNApolIIser5 antibody. Ingenuity pathway analysis identified potential methylated upstream regulators. Their functional role in controlling unmethylated promoters was determined by CRISPR/Cas9 gene editing. RESULTS: We show that a large group of unmethylated promoters is regulated by DNMT1 through... More