Products/Services Used | Details | Operation |
---|---|---|
PCR Cloning and Subcloning> | The nucleotidic sequence of blaSPM-1/Sfh-I was synthesized by Genscript (USA) and PCR amplified with primers SPM-1NdeI-Fw (5′- GTACGTCATATGAATTCACCTAAATCGAGAGC-3′) and SPM-1StHindIII-Rv (5′- GTACGTAAGCTTCTACTTTTCGAATTGTGGGTGAGACCACAGTCTCATTTCGCCAAC 3′) for subcloning into pMBLe-blaSPM-1 plasmid (7) through NdeI and HindIII sites. | Get A Quote |
Metallo-β-lactamases (MBLs) are the major group of carbapenemases produced by bacterial pathogens. The design of MBL inhibitors has been limited by, among other issues, incomplete knowledge about how these enzymes modulate substrate recognition. While most MBLs are broad-spectrum enzymes, B2 MBLs are exclusive carbapenemases. This narrower substrate profile has been attributed to a sequence insertion present in B2 enzymes that limits accessibility to the active site. In this work, we evaluate the role of sequence insertions naturally occurring in the B2 enzyme Sfh-I and in the broad-spectrum B1 enzyme SPM-1. We engineered a chimeric protein in which the sequence insertion of SPM-1 was replaced by the o... More