| Products/Services Used | Details | Operation |
|---|---|---|
| PCR Cloning and Subcloning | Briefly, guide RNA (gRNA) sequences were designed by Optimized CRISPR Design tool (http://crispr.mit.edu/), and CRISPR/Cas9 plasmids including gRNA sequences were purchased from GenScript.CRISPR/Cas9 gRNAs targeting the NICD binding motif of human Notch1 (cloned into a pGS-gRNA-Cas9-Puro vector backbone) were designed and ordered from GenScript with the following inserted gRNA sequences: (gRNA1: TGCTTTT GGGGGATCCGCGT, gRNA2: CACTGCGGGAATTTCCCACG). | Get A Quote |
The intestinal epithelium is the fastest regenerative tissue in the body， fueled by fast-cycling stem cells. The number and identity of these dividing and migrating stem cells are maintained by a mosaic pattern at the base of the crypt. How the underlying regulatory scheme manages this dynamic stem cell niche is not entirely clear. We stimulated intestinal organoids with Notch ligands and inhibitors and discovered that intestinal stem cells employ a positive feedback mechanism via direct Notch binding to the second intron of the Notch1 gene. Inactivation of the positive feedback by CRISPR/Cas9 mutation of the binding sequence alters the mosaic stem cell niche pattern and hinders regeneration in organoids. Dyn... More
