| Products/Services Used | Details | Operation |
|---|---|---|
| CRISPR Plasmids | … S. Munro (Wong & Munro, 2014). The GCC88 CRISPR guide RNA (gRNA) plasmid (gRNA targeting sequence: CAACTGGCCTCTTCGGACTT) was synthesized by Genscript, USA … 6 performed using Lipofectamine 2000 (Thermo Fisher Scientific) according to manufacturer's … | Get A Quote |
GCC88 is a golgin coiled-coil protein at the trans-Golgi (TGN) that functions as a tethering factor for the endosome derived retrograde transport vesicles. Here， we demonstrate that GCC88 is required for the endosome-to-TGN retrograde transport of the cation-independent mannose 6-phosphate receptor (CI-M6PR). The knockout of GCC88 perturbs the retrieval of CI-M6PR and decreases its cellular level at the steady state， which causes the improper processing of newly synthesized cathepsin-D， a lysosomal hydrolase dependent on CI-M6PR for its delivery to lysosomes. At the whole cell level， the knockout of GCC88 reduces the lysosomal proteolytic capacity but does not impair of the efficiency of autophagy withi... More
