Products/Services Used | Details | Operation |
---|---|---|
Custom DNA/RNA Oligos> | … A pair of phosphorylated oligos for the IgM heavy chain J H region (IgM-Cas9_oligo1: CACCGTTGAAGTCGTCGTGTCCTC; IgM-Cas9_oligo2: AAACGAGGACACGACGACTTCAAC) were designed based on the target site sequence, and synthesized by Genscript (China) … | Get A Quote |
Generating B cell-deficient mutant is the first step to produce human antibody repertoires in large animal models. In this study, we applied the clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated (Cas) system to target the JH region of the pig IgM heavy chain gene which is crucial for B cell development and differentiation. Transfection of IgM-targeting Cas9 plasmid in primary porcine fetal fibroblasts (PFFs) enabled inducing gene knock out (KO) in up to 53.3% of colonies analyzed, a quarter of which harbored biallelic modification, which was much higher than that of the traditional homologous recombination (HR). With the aid of somatic cell nuclear transfer (SCNT) technol... More