Products/Services Used | Details | Operation |
---|---|---|
Mutagenesis Services> | For target gene rescue, Elp3-null BM67 cells were incubated with a mixture containing 7.5 ll of Lipofectamine 3000 (Invitrogen) complexed with 2.5 lg of empty vector plasmid or plasmid harboring ELP3 (pcDNA3.1/Hygro(+)-Elp3, Genscript Clone ID OMu06165C with silent mutations on the gRNA binding site: TGTCCACACATCAGTTTCAC > TGCCCTCATATAAGCTTTAC) for 24 h followed by hygromycin selection. | Get A Quote |
Estrogen receptor alpha (ERa) activity is associated with increased cancer cell proliferation. Studies aiming to understand the impact of ERa on cancer-associated phenotypes have largely been limited to its transcriptional activity. Herein, we demonstrate that ERa coordinates its transcriptional output with selective modulation of mRNA translation. Importantly, translational perturbations caused by depletion of ERa largely manifest as “translational offsetting” of the transcriptome, whereby amounts of translated mRNAs and corresponding protein levels are maintained constant despite changes in mRNA abundance. Transcripts whose levels, but not polysome association, are reduced following ERa depletio... More