Products/Services Used | Details | Operation |
---|---|---|
CRISPR Cell Line Engineering> | . To obtain HEK293 derivative cell lines in which SLFN11 expression was obliterated using CRISPR– Cas9, cells were transfected with pSpCas9(BB)-2A-Puro (PX459) all-in-one CRISPR–Cas9 construct, and selected for puromycin resistance (SLFN11 CRISPR–Cas9 guide RNA 4, by guest on August 12, 2019 http://www.jbc.org/ Downloaded from 11 GCAGCCTGACAACCGAGAAA, obtained from GenScript). | Get A Quote |
Human Schlafen 11 (SLFN11) is an interferon stimulated gene (ISG) that we previously have demonstrated to ablate translation of HIV proteins based on the virus' distinct codon preference. Additionally, lack of SLFN11 expression has been linked to the resistance of cancer cells to DNA damaging agents (DDAs). We recently resolved the underlying mechanism, finding that it involves SLFN11-mediated cleavage of select tRNAs predominantly employed in the translation of the ATR and ATM Ser/Thr kinases, thereby establishing SLFN11 as a novel tRNA endo-nuclease. Even though SLFN11 is thus involved in two of the most prominent diseases of our time, cancer and HIV infection, its regulation remained thus far unres... More