Products/Services Used | Details | Operation |
---|---|---|
CRISPR Cell Line Engineering> | gRNAs YKL-40/CHI3L1 KD YKL-40/CHI3L1 SAM OV 1 YKL-40/CHI3L1 SAM OV 2 Sequence CCGCCATTTCTGCGCACCCA AGTTTTGAAAACTTTGGGTC CTGCCAGCAGAAGAGCCACT Action Knockdown Overexpress Overexpress Company Genscript Genscript MORERA ET AL.... Two specific SAM gRNAs for YKL-40 and one empty control were purchased from Genscript containing zeomycin resistance cassettes. | Get A Quote |
Epithelial to mesenchymal transition (EMT) is a developmental event that is hijacked in some diseases such as fibrosis and cancer. In cancer, EMT has been linked to increased invasion and metastasis and is generally associated with a poor prognosis. In this study, we have compared phenotypic and functional differences between two isogenic cell lines with an EMT profile: D492M and D492HER2 that are both derived from D492, a breast epithelial cell line with stem cell properties. D492M is non-tumorigenic while D492HER2 is tumorigenic. Thus, the aim of this study was to analyze the expression profile of these cell lines, identify potential oncogenes, and evaluate their effects on cellular phenotype. We performed tr... More