Products/Services Used | Details | Operation |
---|---|---|
Mutagenesis Services> | The nucleotides of mouse Mef2c gene (−2,131 to −1,718, translational initiation site +1; TAAGCGCTTAGGC AGGCATAGTCCGGTAAGCCGATAGTGCCACAGGTCTCAGCTAAGAG AAAGGAAGGGAAGATGCTCCCATATACTTTGACTTGAGATTCATGGA TTGTTTTTGTTTGTTTGTTTGTTTGTTTTTTGTGGTGGAGAAAGCCT TCTTGTCTCATTGGGGTATTACAAATGCATGGGAAATACAAGTCTGG GCTGCTGCTTGCTTCTTGGGTAAGACTATAGTAAATGCAGAAAAGAT TCCCACTTGTATGCTGTTTAAGACCATTTCTAAGACTAAATGGGTAG ACTATTTAACAATGTTGGATACATCATGTGTGTGCTTTGCAAATTCTTT ATCTATATGATCTTGGTGTCTTTATAGTAGTGTCTTTGCCTTGTGAGTG TCTTAGTGTGTGTTGTTCATAT) containing ACAAAT (−1948) & AAAT (−1935) and AAAT (−1837) & CAAATT (−1788) Foxp2 binding motifs were custom-assembled by DNA synthesis (Neogene Biomedicals Taiwan/Genscript) and then were cloned into the Kpn1 and SacI sites of a pGL3-c-Fos-Luc plasmid (kindly provided by Dr.... To produce the mutant reporter gene plasmids, the sequences of the ACAAAT plus AAAT motifs were mutated to ACGGGT plus GGGT (MT1) to generate an Mef2C-MT1-c-Fos-Luc plasmid by site-directed mutagenesis (Neogene Biomedicals Taiwan/Genscript). | Get A Quote |
Cortico-basal ganglia circuits are critical for speech and language and are implicated in autism spectrum disorder, in which language function can be severely affected. We demonstrate that in the mouse striatum, the gene Foxp2 negatively interacts with the synapse suppressor gene Mef2c. We present causal evidence that Mef2c inhibition by Foxp2 in neonatal mouse striatum controls synaptogenesis of corticostriatal inputs and vocalization in neonates. Mef2c suppresses corticostriatal synapse formation and striatal spinogenesis, but can itself be repressed by Foxp2 through direct DNA binding. Foxp2 deletion de-represses Mef2c, and both intrastriatal and global decrease of Mef2c rescue vocalization and striatal spin... More