Products/Services Used | Details | Operation |
---|---|---|
Synthetic sgRNA and crRNA Service> | … A humanAhR CRISPR/Cas9 guide RNA (AGACCGACTTAATACAGAGT) in a pSpCas9 BB-2A-GFP PX458 vector was purchased from GenScript (Piscataway, NJ). Individual clones were isolated and two of these exhibited the … | Get A Quote |
Tryptophan metabolites exhibit aryl hydrocarbon receptor (AhR) agonist activity and recent studies show that the phenylalanine metabolites serotonin and carbidopa, a drug used in treating Parkinson's disease, activated the AhR. In this study, we identified the neuroactive hormone dopamine as an inducer of drug metabolizing enzymes CYP1A1, CYP1B1, and UGT1A1 in colon and glioblastoma cells and similar results were observed for carbidopa. In contrast, carbidopa but not dopamine exhibited AhR activity in BxPC3 pancreatic cancer cells whereas minimal activity was observed for both compounds in Panc1 pancreatic cancer cells. In contrast to a previous report, the induction responses and cytotoxicity of carbidopa was ... More