Products/Services Used | Details | Operation |
---|---|---|
Custom DNA/RNA Oligos> | … penicillin/streptomycin. 3 sgRNAs targeting human BAP1 in the pLentiCRISPRv2 backbone were purchased from GenScript, along with a non-targeting control sgRNA. The sgBAP1 sequences are: #1 CCTGATCGTAGGTGTCAAAG, #4 TCTACCCCATTGACCATGGT, and #5 … | Get A Quote |
objective: Cholangiocarcinoma (CCA) is a deadly and highly therapy-refractory cancer of the bile ducts, with early results from immune checkpoint blockade trials showing limited responses. Whereas recent molecular assessments have made bulk characterizations of immune profiles and their genomic correlates, spatial assessments may reveal actionable insights. unassigned: Here, we have integrated immune checkpoint-directed immunohistochemistry with next-generation sequencing of resected intrahepatic CCA samples from 96 patients. We found that both T-cell and immune checkpoint markers are enriched at the tumor margins compared to the tumor center. Using two approaches, we identify high programmed cell death protein... More