Products/Services Used | Details | Operation |
---|---|---|
Custom Vector Construction> | … Such designed, linear DNA knock-in 535 cassette was synthesized (GenScript). The vectors pCas and pTargetF were gifts from Sheng 536 Yang (Addgene plasmids #62225 and #62226). The N20 sequence 537 (GGTCAGCGGATGCGTTTCGG) was introduced into pTargetF … | Get A Quote |
Respiratory complex I is a multi-subunit membrane protein complex that reversibly couples NADH oxidation and ubiquinone reduction with proton translocation against transmembrane potential. Complex I from is among the best functionally characterized complexes, but its structure remains unknown, hindering further studies to understand the enzyme coupling mechanism. Here, we describe the single particle cryo-electron microscopy (cryo-EM) structure of the entire catalytically active complex I reconstituted into lipid nanodiscs. The structure of this mesophilic bacterial complex I displays highly dynamic connection between the peripheral and membrane domains. The peripheral domain assembly is stabilized by unique ... More