Products/Services Used | Details | Operation |
---|---|---|
Synthetic sgRNA and crRNA Service> | … synthesis (GenScript). In both cases, double-strand break was directed using a single-guide RNA (sgRNA; sequence 5′- CCUUUAUACACAGGAUACUGUAA′), which was tested by … | Get A Quote |
All tissue-resident macrophages of the central nervous system (CNS)-including parenchymal microglia, as well as CNS-associated macrophages (CAMs) such as meningeal and perivascular macrophages-are part of the CNS endogenous innate immune system that acts as the first line of defence during infections or trauma. It has been suggested that microglia and all subsets of CAMs are derived from prenatal cellular sources in the yolk sac that were defined as early erythromyeloid progenitors. However, the precise ontogenetic relationships, the underlying transcriptional programs and the molecular signals that drive the development of distinct CAM subsets in situ are poorly understood. Here we show, using fate-mapping sys... More