Products/Services Used | Details | Operation |
---|---|---|
Plasmid DNA Preparation> | To generate BAK1 knockout cells, HeLa and H23 cell lines were transfected with pSpCas9-BB-2A-GFP plasmid (GenScript)-containing single guide RNA (sgRNA) coding sequence (GTTGATGTCGTCCCCGATGA) targeting BAK1 gene (GenScript, Piscataway, NJ, USA) | Get A Quote |
BH3 mimetics represent a promising tool in cancer treatment. Recently, the drugs targeting the Mcl-1 protein progressed into clinical trials, and numerous studies are focused on the investigation of their activity in various preclinical models. We investigated two BH3 mimetics to Mcl-1, A1210477 and S63845, and found their different efficacies in on-target doses, despite the fact that both agents interacted with the target. Thus, S63845 induced apoptosis more effectively through a Bak-dependent mechanism. There was an increase in the level of Bcl-xL protein in cells with acquired resistance to Mcl-1 inhibition. Cell lines sensitive to S63845 demonstrated low expression of Bcl-xL. Tumor tissues from patients wit... More