Products/Services Used | Details | Operation |
---|---|---|
PCR Cloning and Subcloning> | ... A D51E mutation was introduced to ctrA by site-directed mutagenesis with primers HI939 (GGTTCAGTTCGAGGAGAATGATGTCG) and HI940 (TCCTCGAACTGAACCTGCCGGACAT) using a CloneEZ PCR cloning kit (GenScript, Piscataway, NJ, USA). ... | Get A Quote |
Identifying functional elements in promoter sequences is a major goal in computational and experimental genome biology. Here, we describe an algorithm, Local Distribution of Short Sequences for Prokaryotes (LDSS-P), to identify conserved short motifs located at specific positions in the promoters of co-expressed prokaryotic genes. As a test case, we applied this algorithm to a symbiotic nitrogen-fixing bacterium, Sinorhizobium meliloti The LDSS-P profiles that overlap with the 5' section of the extracytoplasmic function RNA polymerase sigma factor RpoE2 consensus sequences displayed a sharp peak between -34 and -32 from TSS positions. The corresponding genes overlap significantly with RpoE2 targets identified f... More