| Products/Services Used | Details | Operation |
|---|---|---|
| Gene Synthesis | RNA extracted from the samples was treated with DNase I amplification grade (Sigma-Aldrich, Germany) to remove any traces of genomic DNA according to the manufacturer’s instructions. cDNA was synthesized from 1.0 µg of total RNA using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific Inc) containing oligo dT primers according to manufacturer’s instructions. Freshly prepared cDNAs were amplified by GAPDH gene specific primers (Forward primer 5'- GAAGGATCGGTAGGTTGGTG -3' and Reverse primer 5'-CCTTGACTTTGAGCTCGTGA -3'). The primer was designed using Genscript primer designing tool with default parameters. PCR reactions were carried out in a final volume of 25 µl reaction mixture containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 200 µM dNTP, 0.2 µM each primer, 2.0 µl cDNA and 0.5 U of Taq DNA polymerase. PCR was performed using thermo cycler condition which was initiated by a hot start at 95°C for 5 min followed by 30 cycles of 95°C for 30 s, 50°C for 30 s and 72°C for 45 s with a 72°C for 5 min final extension. Minus RT control PCR was carried out with 0.5 µg of total RNA instead of cDNA to check DNA contamination. In addition, a H2O control (without template) was set to check whether the PCR signal is resulting from specific cDNA amplification. The PCR products were resolved on a 1.5% agarose gel and visualized under ultraviolet light. | Get A Quote |
High quality RNA extraction from field-grown jute plants can be difficult due to the presence of complex polyphenolic, polysaccharide and waxes. But isolation of RNA in high quality is a basic need in plant genetics, genomics, transcriptomics, molecular biology and related physiological investigations. Here, cetyl trimethyl ammonium bromide (CTAB) based modified RNA isolation protocol suitable for isolating high quality total RNA from different parts of field-grown jute plants was reported. Modifications come with two extra wash with extraction buffer, residual polysaccharides precipitation with absolute ethanol and potassium acetate during phenol:chloroform:isoamyl alcohol (PCI), intermediate pelleting with li... More
