| Products/Services Used | Details | Operation |
|---|---|---|
| Gene Synthesis | The spacer was designed to be complementary to fungal DNA based on alignments of the primer to a random selection of sequences downloaded from GenBank. Each reaction consisted of 1× PCR buffer, 0.2 mM dNTP mixture, 1 µM of each primer, 0.15 µl of GeneScript Taq polymerase (GenScript, Piscataway, NJ), and 2 µl of template DNA extract in a total volume of 15 µl. The thermocycler profile was 3 min at 94°C, followed by 30 cycles of 30 s at 94°C, 45 s at 60°C, and 1 min at 72°C with a final elongation for 7 min at 72°C. The oomycete PCR was seminested and used ITS6 (GAAGGTGAAGTCGTAACAAGG) and ITS4 (TCCTCCGCTTATTGATATGC) without the MiSeq adapters followed by ITS6 (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGKGAAGGTGAAGTCGTAACAAGG) and ITS7 (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGAGCGTTCTTCATCGATGTGC) with the MiSeq adapters (Sapkota and Nicolaisen 2015). The reactions for the first PCR consisted of 1× PCR buffer, 1.5 mM MgCl2, 0.2 mM dNTP mixture, 0.2 µM of each primer, 0.04 units Platinum Taq polymerase (ThermoFisher Scientific, Waltham, MA), and 7.5 µl of template DNA extract in a total volume of 15 µl. The thermocycler profile was 2 min at 94°C, followed by 25 cycles of 30 s at 94°C, 30 s at 60°C, and 1 min at 72°C with a final elongation for 2 min at 72°C. The second PCR had the same reaction composition and thermocycler profile, except that 1.5 µl of a 1:10 dilution of the first PCR was used as the template. | Get A Quote |
The microbiome of agricultural crops influences processes such as nutrient absorption, drought stress, and susceptibility to pathogens. Interactions between a plant’s genotype and its environment influence the composition of the microbiome, but these interactions are not well understood. We compared how the fungal and oomycete microbiomes of rhododendrons from Oregon nurseries differed among cultivars, growth conditions, and nurseries. Roots were sampled from randomly selected container and field-grown plants of three cultivars of rhododendron at four nurseries. The internal transcribed spacer 1 (ITS1) barcode was sequenced with the Illumina MiSeq using two sets of primers specific to fungi and oomycetes, res... More
